Molecular Lab Tools calculator

Guide RNA GC Checker

Calculate guide RNA GC content, base counts, and simple CRISPR guide quality warnings from a spacer sequence. Use it for classroom work, protocol planning, and quick wet-lab checks before you verify final values independently.

Guide RNA sequence

Paste the spacer only. T is treated as U.

GC result

52.63%

GC content is in a commonly useful screening range.

Length 19 ntG 7C 3A 8U 1

Guide RNA GC Checker interface showing inputs, calculated results, and molecular lab workflow cards

Guide RNA GC Checker explained

This guide RNA GC checker calculates the percentage of G and C bases in a CRISPR spacer sequence.

A common Cas9 guide is about 20 nucleotides long, and GC content is often reviewed because very low or very high values can affect guide behavior.

The tool converts T to U, removes spaces, counts each base, and reports whether the sequence looks balanced for a first-pass design screen.

The calculator handles empty fields, invalid numbers, and common input formatting mistakes. It gives a clear result and a short interpretation so users can decide what to check next. Students can use the page to learn the calculation logic. Lab workers can use it to reduce manual arithmetic errors. Researchers can use it as a first-pass planning aid before confirming the design with the relevant protocol, reagent datasheet, or analysis software.

For background reading, see this trusted reference: supporting educational source.

Guide RNA GC Checker worked example

Given guide GAGTCCGAGCAGAAGAAGAG, the tool counts G and C bases, divides that count by total guide length, and reports GC percentage with a short interpretation.

The result should be treated as a planning estimate. Always verify critical lab calculations independently before using them in real experiments.

For related planning, you may also use the CRISPR gRNA Design Helper or compare the next step with the Guide RNA Length Checker.

Practical questions about Guide RNA GC Checker

Can I use this result directly in an experiment?

Use the result as a careful planning estimate. Recheck important values with your protocol, instrument settings, and reagent documentation.

Why does the tool show warnings?

The warnings catch common mistakes such as missing required values, impossible negative values, unsuitable sequence characters, or values outside a typical screening range.

Does the tool replace experimental validation?

No. It supports calculation and screening, but final biological performance depends on the sample, assay, protocol, and experimental controls.