Molecular sequence tool

DNA Sequence Analyzer

Use this DNA Sequence Analyzer to check sequence length, GC content, base composition, reverse complement, RNA transcript, codon count, and simple quality notes from one clean input.

Working DNA analysis tool

Analyze a DNA sequence

Paste a DNA sequence to calculate length, base composition, GC content, AT content, reverse complement, RNA transcript, codon count, and simple sequence-quality notes.

FASTA headers, spaces, numbers, and line breaks are ignored. Standard IUPAC DNA ambiguity codes are accepted for counting and reverse complement output.

Length33bases
GC content48.48%exact A/C/G/T bases
AT content51.52%
Exact bases33
Ambiguous bases0
Frame 1 codons11
A: 8
C: 7
G: 9
T: 9
N: 0
Other IUPAC: 0

Reverse complement

TTAGCTAGCTACCGTACGATCGTAAGCAGCCAT

RNA transcript

AUGGCUGCUUACGAUCGUACGGUAGCUAGCUAA

Frame 1 quick scan

ATG codons1
Stop codons1
First codonsATG GCT GCT TAC GAT CGT ACG GTA GCT AGC

Sequence notes

  • No major beginner-level sequence issues were detected.

Educational sequence analysis only. Verify critical cloning, PCR, sequencing, and diagnostic calculations independently before lab use.

DNA Sequence Analyzer dashboard showing sequence length, GC content, base composition, reverse complement, and codon scan results

DNA Sequence Analyzer for quick sequence checks

A DNA Sequence Analyzer reads a nucleotide sequence and reports its most useful properties. It gives direct answers for sequence length, base composition, GC content, AT content, reverse complement, RNA transcript, codon count, and simple quality warnings.

Students can use it to understand DNA sequence structure. Lab workers can use it for quick checks before PCR, cloning, sequencing, and primer review. Teachers can use it to create practical examples for genetics, molecular biology, and biotechnology lessons.

How to use the DNA Sequence Analyzer

Paste a DNA sequence into the input box. You can paste a plain sequence or a FASTA-style entry. The tool ignores FASTA headers, spaces, numbers, and line breaks. It accepts A, C, G, T, and standard IUPAC DNA ambiguity codes such as N, R, Y, S, W, K, M, B, D, H, and V.

Use the result cards to read the main values first. Length shows the total accepted DNA bases. Exact bases count only A, C, G, and T. Ambiguous bases show symbols that represent more than one possible nucleotide. The copy button helps you move the results into a lab notebook, worksheet, or report draft.

DNA sequence length, GC content, and base composition

GC content is the percentage of guanine and cytosine bases in the exact part of the sequence. The formula is G plus C divided by A plus C plus G plus T, multiplied by 100. AT content uses the same denominator and reports adenine plus thymine percentage.

GC content affects melting behavior, primer design, PCR conditions, and sequence stability. A very low GC sequence can bind weakly. A very high GC sequence can form strong secondary structures or require adjusted amplification conditions. For a focused percentage check, use the GC Content Calculator.

Reverse complement and RNA transcript output

The reverse complement helps you read the opposite DNA strand in the 5′ to 3′ direction. The analyzer pairs A with T and C with G. It also supports IUPAC ambiguity complements, so R becomes Y, K becomes M, and N remains N.

The RNA transcript output replaces thymine with uracil. This is useful when you want a simple transcription-style conversion from a coding DNA sequence to an RNA sequence. For a dedicated strand tool, use theReverse Complement Generator.

Codon scan and coding sequence review

The codon scan groups the sequence into triplets from the first base. It reports the number of complete codons, ATG start codons, and stop codons in frame 1. This helps you notice whether a sequence may contain a coding region or whether the pasted sequence has a frame problem.

A coding sequence usually works in groups of three bases. If the length is not divisible by 3, the final bases do not form a full codon in the selected frame. This tool does not replace a full ORF search across all six reading frames, but it gives a fast first-pass scan.

When to use this DNA Sequence Analyzer

Use this tool before writing a lab report, checking a primer region, reviewing a cloning insert, preparing a sequencing explanation, or teaching nucleotide composition. It also helps when you need to clean a pasted FASTA sequence and quickly see whether unsupported characters are present.

Before real lab work, verify the strand direction, exact sequence, target specificity, expected amplicon size, restriction sites, primer pair behavior, and supplier requirements. Educational analysis gives a useful starting point, but critical PCR, cloning, and sequencing decisions need independent confirmation.

For background on FASTA sequence records and biological sequence formatting, see the NCBI information about FASTA sequence format.NCBI FASTA format

Related tools

Student and lab questions

DNA Sequence Analyzer questions

What does a DNA Sequence Analyzer calculate?

It calculates DNA sequence length, A/C/G/T composition, GC content, AT content, ambiguous base count, reverse complement, RNA transcript, codon count, and simple quality notes.

Can I paste a FASTA sequence into this tool?

Yes. FASTA header lines, spaces, line breaks, and numbers are ignored, so you can paste a sequence directly from many common sequence files.

Does this DNA Sequence Analyzer support IUPAC codes?

Yes. It accepts standard IUPAC DNA ambiguity codes for length and reverse complement output. GC and AT percentages use exact A, C, G, and T bases only.

Can I use this analyzer before PCR or cloning?

Yes. It is useful for quick checks before PCR, cloning, sequencing, primer review, and student lab reports. Critical lab designs should still be verified independently.

Why is my sequence length not divisible by 3?

A coding sequence is usually read in codons of three bases. If the length is not divisible by 3, the last bases do not form a complete codon in the selected frame.