Molecular Lab ToolsFree lab calculators

DNA and RNA sequence tool

Reverse Complement Generator

Generate the reverse complement of a DNA or RNA sequence. The tool also returns the complement, reverse sequence, cleaned input, GC content, length, and base composition.

Working sequence converter

Generate a reverse complement

Paste a DNA or RNA sequence in 5′ to 3′ direction. The tool returns the cleaned sequence, complement, reverse sequence, and reverse complement with base composition checks.

DNA mode accepts A, C, G, T and IUPAC ambiguity codes. RNA mode accepts A, C, G, U and IUPAC ambiguity codes.

FASTA headers, spaces, line breaks, and numbers are ignored. Paste the strand as written from 5′ to 3′.

Length

20 nt

GC content

50%
A: 5
C: 4
G: 6
T: 5
Ambiguous: 0
Type: DNA

Reverse complement

TCGTACGCTAACGTACGCAT

Complement

TACGCATGCAATCGCATGCT

Reverse only

AGCATGCGATTGCATGCGTA

Cleaned input

ATGCGTACGTTAGCGTACGA

Interpretation

The reverse complement is the sequence you read after reversing the strand and replacing each base with its pairing partner. Use it when checking primers, antisense strands, cloning inserts, and DNA sequence orientation.

Educational sequence conversion only. Verify strand direction and critical cloning or primer decisions independently before real lab use.

Reverse Complement Generator interface showing DNA sequence input, reverse complement output, base pairing, and GC content cards

Reverse Complement Generator for DNA and RNA

A reverse complement generator converts a nucleotide sequence into the opposite strand sequence written in the correct direction. In DNA, A pairs with T and C pairs with G. In RNA, A pairs with U and C pairs with G. The tool reverses the input sequence and then applies these base-pairing rules.

You can use this page for primers, short synthetic oligos, sequencing reads, restriction site checks, cloning inserts, antisense strand review, and homework problems. It accepts plain sequences and FASTA-style input. It removes spaces, line breaks, and numbers so the output stays clean.

How reverse complement output is calculated

The calculation has two steps. First, the tool makes the complement by replacing each base with its pairing partner. Second, it reverses the complemented sequence so the final output is written 5′ to 3′. This is why a reverse complement is not the same as a simple reversed sequence.

For example, the DNA sequence 5′-ATGC-3′ has the complement TACG. After reversing that complement, the reverse complement is 5′-GCAT-3′. The same logic applies to longer primers and DNA fragments.

Using reverse complements in primer and cloning work

Molecular biology workflows often require strand direction checks. A primer binds to the complementary strand, but the sequence is normally written 5′ to 3′. This tool helps you confirm whether a primer, insert, or target region is shown in the expected orientation.

If you are checking primers, combine this conversion with a primer melting temperature check. If you are reviewing a larger sequence before cloning or annotation, compare the result with the DNA Sequence Analyzer to inspect length, composition, and sequence features.

IUPAC ambiguity codes in reverse complements

This generator supports common IUPAC ambiguity symbols. R changes to Y, Y changes to R, K changes to M, M changes to K, B changes to V, V changes to B, D changes to H, H changes to D, and N remains N. These codes are useful when a sequence position may represent more than one possible nucleotide.

The tool still validates the input. If DNA mode contains U, it asks you to convert or remove it. If RNA mode contains T, it asks you to convert or remove it. This prevents silent mistakes when moving between DNA and RNA notation.

What to check before using the result

Confirm the original strand direction, the molecule type, and whether your sequence uses DNA or RNA bases. Also check whether your source sequence includes adapters, restriction sites, overhangs, or primer tails. These extra regions may be intentional, but they can change how you interpret the output.

For classroom use, this tool shows complement, reverse-only, and reverse-complement outputs side by side. That makes it easier to explain the difference between base pairing and strand orientation. For real lab use, verify critical primer, sequencing, and cloning decisions independently with your protocol or supervisor.

For background on nucleotide base pairing and nucleic acid structure, see the NCBI Bookshelf overview of DNA structure and replication.NCBI Bookshelf DNA structure reference

Related tools

DNA Sequence AnalyzerInspect sequence length, base composition, and DNA properties.Primer Tm CalculatorEstimate primer melting temperature for PCR planning.Restriction Site FinderFind enzyme recognition sites inside DNA sequences.

Student questions

Questions About Reverse Complement Sequences

What does a reverse complement generator do?

It reverses a DNA or RNA sequence and replaces each base with its pairing partner, such as A with T in DNA or A with U in RNA.

Should I paste the sequence in 5′ to 3′ direction?

Yes. Most sequence records and primer sequences are written 5′ to 3′, and this tool interprets the pasted strand in that direction.

Can this tool handle IUPAC ambiguity codes?

Yes. It supports common IUPAC ambiguity codes such as R, Y, S, W, K, M, B, D, H, V, and N for DNA and RNA sequences.

Is reverse complement the same as reverse sequence?

No. The reverse sequence only changes order. The reverse complement changes order and also replaces each base with its complementary base.

When do I need a reverse complement?

You may need it when checking PCR primers, antisense strands, cloning inserts, sequencing reads, restriction sites, and target orientation.