CRISPR guide specificity

Off-Target Risk Checker

Compare a CRISPR guide spacer with candidate genomic sites and flag close matches using total mismatches and PAM-proximal seed mismatches.

CRISPR specificity screen

Check guide similarity against candidate sites

Paste a guide spacer and candidate genomic matches. The checker counts total mismatches and PAM-proximal seed mismatches.

Result summary

1 candidate site need higher review.
Guide length 20 nt3 candidate sites
Higher review
GAGTCCGAGCAGAAGAAGAG PAM GG
0 total mismatches · 0 seed mismatches. Close match near the PAM-proximal seed. Review with a genome-wide tool.
Moderate review
GAGTCCGAGCAGAAGAAAAG PAM GG
1 total mismatches · 1 seed mismatches. Some mismatches are present, but the site still deserves review.
Moderate review
TTGTCCGAGCAGAAGAAAAG PAM GG
3 total mismatches · 1 seed mismatches. Some mismatches are present, but the site still deserves review.
Off-Target Risk Checker interface showing guide RNA mismatches, seed region, PAM status, and risk score

Off-Target Risk Checker results explained

This calculator helps you compare one guide RNA spacer against a list of possible genomic matches. It is useful when you already have candidate sites from BLAST, alignment software, or manual sequence review. The tool counts mismatches across the spacer and also checks the PAM-proximal seed region. A close seed match deserves extra review because many CRISPR nucleases depend strongly on bases near the PAM.

The checker accepts DNA or RNA guide notation. It converts U to T for comparison and removes spacing or pasted formatting. Candidate sites can include the spacer followed by a short PAM sequence, such as NGG-like sequence text for a Cas9 workflow. The output is a screening estimate, not a final safety statement. For real genome editing, verify guides with organism-specific off-target tools and experimental controls.

Off-target screening worked example

Given guide spacer: GAGTCCGAGCAGAAGAAGAG. Candidate site one is an exact spacer match followed by NGG. Candidate site two has one mismatch outside part of the spacer. Candidate site three has several mismatches. The calculator reports total mismatches, seed mismatches, and a review label for each candidate site.

A higher-review result means the candidate site is close enough that you should inspect it carefully. A lower-review result only means this simple mismatch list looks less similar. It does not prove that the guide has no off-target activity elsewhere in the genome.

Practical notes for guide selection

Use this page after a broader CRISPR design step when you want a quick comparison table. Check guide length, GC content, PAM type, seed-region similarity, and target location before ordering oligos. Avoid guides with many close genomic matches. Also avoid interpreting a single score as a guarantee because chromatin, nuclease type, cell type, and repair pathway can change editing outcomes.

Students can use the checker to learn why guide specificity depends on sequence similarity. Lab workers can use it to organize candidate-site review notes before choosing which guide to test. Researchers can paste short alignment lists and quickly separate exact matches, near matches, and weaker matches.

CRISPR gRNA Design Helper
Design guide candidates before specificity review.
Guide RNA GC Checker
Check whether guide GC content is in a practical range.
PAM Sequence Finder
Find PAM motifs near candidate target sites.

Questions About Off-Target Risk Checking

Does this replace genome-wide CRISPR software?

No. It is a simple sequence comparison helper. Use genome-aware tools before real editing work.

What does a seed mismatch mean?

A seed mismatch is a mismatch close to the PAM-proximal end of the guide. Seed similarity can be important for target binding.