Molecular Lab Tools

PAM Sequence Finder

Scan DNA for SpCas9 NGG, Cas12a TTTV, or custom PAM motifs and export candidate guide positions.

Use this calculator for planning and learning. Verify critical lab calculations independently before using them in real experiments.

Find CRISPR PAM sites on both strands

Scan DNA for SpCas9 NGG, Cas12a TTTV, or a custom PAM pattern.

Both strands
Spaces, numbers, and FASTA-like text are ignored except valid DNA letters.
N = any base. V = A/C/G.
Usually 20 nt for SpCas9; many Cas12a workflows use longer spacers.

PAM matches

6

Pattern scanned: NGG. Candidate guides should still be checked for genomic specificity and experimental context.

StrandPAM positionPAMGuideGC %
+27TGGGAGTCCGAGCAGAAGAAGAG55%
+34CGGAGCAGAAGAAGAGTGGTTAC45%
+46AGGGTGGTTACCGGTTTAAACCC50%
-36CGGGTAACCACTCTTCTTCTGCT45%
-42CGGACTCTTCTTCTGCTCGGACT50%
-43GGGCTCTTCTTCTGCTCGGACTC55%
PAM Sequence Finder interface showing DNA sequence, PAM pattern, guide spacer, strand, and CRISPR target matches

PAM Sequence Finder results explained

PAM Sequence Finder helps you turn routine laboratory inputs into a clear result without scattered manual arithmetic.

The calculator is designed for students, teachers, wet-lab workers, and researchers who need a fast check before writing a protocol.

It keeps the tool at the top of the page, gives the formula near the result, and shows practical interpretation after the calculation.

The page uses short labels, large input fields, copy buttons, examples, and reset controls so it is easier to use on mobile and desktop screens.

PAM Sequence Finder results formula

For SpCas9, the tool looks for an NGG PAM and reports the upstream guide-sized spacer. For Cas12a, it looks for a TTTV PAM and reports the downstream spacer.

The most common mistake is mixing units before the calculation.

Another common mistake is treating a screening estimate as a final experimental guarantee.

This tool avoids silent results when an input is empty, negative, zero, or outside a useful range.

PAM discovery is only the first filter in CRISPR design. You still need to check specificity, genome context, off-target risk, and nuclease protocol details.

PAM Sequence Finder results worked example

If a sequence contains a 20 nt guide region followed by TGG, the TGG is reported as the PAM and the adjacent guide is listed with strand, position, and GC percentage.

The result tells you what to pipette, what concentration to expect, or what sequence feature was found.

Use the copy result button when you want to transfer the calculation into a notebook, worksheet, or protocol draft.

Practical lab use

Students can use this page to understand the relationship between the input values and the final result.

Lab workers can use it as a quick pre-check before preparing tubes, buffers, standards, or sequence screens.

Researchers can use it to compare alternative setups before selecting the final experimental design.

The calculator is intentionally conservative in its warnings because real samples, instruments, and protocols add context that a browser tool cannot fully know.

Always compare the output with your reagent label, supplier instructions, and local lab protocol.

Questions users often ask

Can I use this result directly in the lab?

Use it as a planning calculation, then independently verify critical values before real experiments.

Why does the calculator reject some inputs?

Values such as zero volume, negative concentration, invalid sequence characters, or impossible dilution conditions would create misleading results.

Does the result replace protocol optimization?

No. It helps avoid arithmetic mistakes, but protocol performance still depends on sample quality, reagent behavior, and assay conditions.

For background reading, see the Addgene CRISPR guide.